lncipedia.org valuation and analysis
Robots.txt Information
| Robot | Path | Permission |
| GoogleBot | / | ✔ |
| BingBot | / | ✔ |
| BaiduSpider | / | ✔ |
| YandexBot | / | ✔ |
Meta Tags
| Title | LNCipedia |
| Description | A comprehensive compendium of human long non-coding |
| Keywords | N/A |
Server Information
| WebSite | |
| Host IP | 157.193.231.62 |
| Location | Belgium |
Related Websites
| Site | Rank |
More to Explore
lncipedia.org Valuation
|
US$3,198,313
Last updated: 2023-05-10 15:59:29
lncipedia.org has Semrush global rank of 3,309,340. lncipedia.org has an estimated worth of US$ 3,198,313, based on its estimated Ads revenue. lncipedia.org receives approximately 369,037 unique visitors each day. Its web server is located in Belgium, with IP address 157.193.231.62. According to SiteAdvisor, lncipedia.org is safe to visit. |
Traffic & Worth Estimates
| Purchase/Sale Value | US$3,198,313 |
| Daily Ads Revenue | US$2,953 |
| Monthly Ads Revenue | US$88,569 |
| Yearly Ads Revenue | US$1,062,824 |
| Daily Unique Visitors | 24,603 |
| Note: All traffic and earnings values are estimates. | |
DNS Records
| Host | Type | TTL | Data |
| lncipedia.org. | A | 1798 | IP: 157.193.231.62 |
| lncipedia.org. | NS | 86400 | NS Record: ns4.combell.net. |
| lncipedia.org. | NS | 86400 | NS Record: ns3.combell.net. |
| lncipedia.org. | MX | 3600 | MX Record: 10 mx.mailprotect.be. |
| lncipedia.org. | MX | 3600 | MX Record: 50 mx.backup.mailprotect.be. |
HtmlToTextCheckTime:2023-05-10 15:59:29
| LNCipedia .org v. 5.2 A comprehensive compendium of human long non-coding RNAs --> LNC ipedia version 5.2 Submit New lncRNA New paper Download About Info History Rest API Contact Genome GRCh38/hg38 GRCh37/hg19 Login Register A comprehensive compendium of human long non-coding RNAs UAUUUUUAUUUUUUAAAAUCUGAUUUGGUGUUCCAU UGUGAGUGUGAGAGCGAGAACAGCGCUGGCUGGGGA GCAGAUCUGCAGAAUUGAAAUGACCUGGCACUUGUC ACAAAAGACCCAAAGUGCAUUGCUGUGGAAAUCAUAG UGUGAGUGUGAGAGCGAGAACAGCGCUGGCUGGGGAC UGUGAGUGUGAGAGCGAGAACAGCGCUGGCUGGGGA GCAGAUCUGCAGAAUUGAAAUGACCUGGCACUUGUC ACAAAAGACCCAAAGUGCAUUGCUGUGGAAAUCAUAG CAAAAGACCCAAAGUGCAUUGCUGUGGAAAUCAUAGAUU CAUUGCUGUGGAAAUCAUAGAUCAAAAGACCCAAAGUG Data LNCipedia is a public database for long non-coding RNA (lncRNA) sequence and annotation. The current release contains 127,802 transcripts and 56,946 genes . Literature Currently, LNCipedia offers 2,482 manually curated lncRNA articles. Recently added literature Tools LNCipidia comes with some helpful tools: Rest API IGV |
HTTP Headers
HTTP/1.1 301 Moved Permanently Server: nginx/1.16.0 Date: Wed, 03 Nov 2021 01:20:24 GMT Content-Type: text/html Content-Length: 169 Connection: keep-alive Location: https://lncipedia.org/ HTTP/2 200 server: nginx/1.16.0 date: Wed, 03 Nov 2021 01:20:25 GMT content-type: text/html;charset=UTF-8 content-length: 18320 |
lncipedia.org Whois Information
Domain Name: LNCIPEDIA.ORG Registry Domain ID: D165146300-LROR Registrar WHOIS Server: whois.ascio.com Registrar URL: http://www.ascio.com Updated Date: 2021-03-30T01:49:00Z Creation Date: 2012-03-29T15:35:07Z Registry Expiry Date: 2022-03-29T15:35:07Z Registrar: Ascio Technologies, Inc. Danmark - Filial af Ascio technologies, Inc. USA Registrar IANA ID: 106 Registrar Abuse Contact Email: abuse@ascio.com Registrar Abuse Contact Phone: +1.4165350123 Domain Status: ok https://icann.org/epp#ok Registrant Country: BE Name Server: NS3.COMBELL.NET Name Server: NS4.COMBELL.NET DNSSEC: unsigned URL of the ICANN Whois Inaccuracy Complaint Form https://www.icann.org/wicf/) >>> Last update of WHOIS database: 2021-09-28T08:16:57Z <<< |